Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1699557
End position: 1699601
Length: 45

DNA sequence
>NC_015145, from 1699557 to 1699601 (45 bp); Arthrobacter phenanthrenivorans Sphe3 TGCGGGCGCTTCCTGTGCGGGTGCTTCTTCAGCCGGTGCTTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1698157-1699920	Sequence	Asphe3_15870 - 2-oxoglutarate dehydrogenase E2 component (Protein is coded in complementary strand; from 1699920 to 1698157)