Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1556714
End position: 1556758
Length: 45

DNA sequence
>NC_015145, from 1556714 to 1556758 (45 bp); Arthrobacter phenanthrenivorans Sphe3 AGAAGCACCCAAGCAGGAGGCACCAAAGCAGGAGGCACCCAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1555984-1556997	Sequence	Asphe3_14610 - translation initiation factor 3 (bIF-3)