Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1519133
End position: 1519156
Length: 24

DNA sequence
>NC_015145, from 1519133 to 1519156 (24 bp); Arthrobacter phenanthrenivorans Sphe3 ACCGGGACCGTGACCAGGACCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1518419-1520173	Sequence	Asphe3_14230 - HNH endonuclease (Protein is coded in complementary strand; from 1520173 to 1518419)