Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1391061
End position: 1391084
Length: 24

DNA sequence
>NC_015145, from 1391061 to 1391084 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GCGCCTTCGCCTGCGCCCGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1390012-1391700	Sequence	Asphe3_13020 - serine/threonine protein kinase