Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1151551
End position: 1151574
Length: 24

DNA sequence
>NC_015145, from 1151551 to 1151574 (24 bp); Arthrobacter phenanthrenivorans Sphe3 GGGCTGGGGCTGGGGCAGGGACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1151147-1152322	Sequence	Asphe3_10970 - hypothetical protein (Protein is coded in complementary strand; from 1152322 to 1151147)