Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1123682
End position: 1123705
Length: 24

DNA sequence
>NC_015145, from 1123682 to 1123705 (24 bp); Arthrobacter phenanthrenivorans Sphe3 CTTCGTCGTCGTCTTCATCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1123582-1124565	Sequence	Asphe3_10710 - monosaccharide ABC transporter membrane protein, CUT2 family