Sequence retrieval

Genome: Arthrobacter phenanthrenivorans Sphe3
Start position: 1022619
End position: 1022663
Length: 45

DNA sequence
>NC_015145, from 1022619 to 1022663 (45 bp); Arthrobacter phenanthrenivorans Sphe3 GCGCCATCAGGAAACACGCCAGCAGGAAACACGCCAGCAGGAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1021085-1022689	Sequence	Asphe3_09780 - penicillin-binding protein, beta-lactamase class C (Protein is coded in complementary strand; from 1022689 to 1021085)