Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 714147
End position: 714176
Length: 30

DNA sequence
>NC_015144, from 714147 to 714176 (30 bp); Weeksella virosa DSM 16922 ATATTTTACCACAATTTACCATTTTTTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 713653-714159	Sequence	Weevi_0692 - protein mraZ (Protein is coded in complementary strand; from 714159 to 713653)