Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 643240
End position: 643263
Length: 24

DNA sequence
>NC_015144, from 643240 to 643263 (24 bp); Weeksella virosa DSM 16922 TCTTTTTTTCTTTTGTTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 643223-643642	Sequence	Weevi_0632 - hypothetical protein (Protein is coded in complementary strand; from 643642 to 643223)