Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 630042
End position: 630065
Length: 24

DNA sequence
>NC_015144, from 630042 to 630065 (24 bp); Weeksella virosa DSM 16922 CACTCAACCACTCAACCACTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 630062-631108	Sequence	Weevi_0620 - dTDP-glucose 4,6-dehydratase (Protein is coded in complementary strand; from 631108 to 630062)