Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 466876
End position: 466903
Length: 28

DNA sequence
>NC_015144, from 466876 to 466903 (28 bp); Weeksella virosa DSM 16922 ATGGTTTATGATTTTTGGTTTATGGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 466642-466878	Sequence	Weevi_0463 - hypothetical protein (Protein is coded in complementary strand; from 466878 to 466642)
ORF... 466882-467211	Sequence	Weevi_0464 - rhodanese-like protein (Protein is coded in complementary strand; from 467211 to 466882)