Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 311505
End position: 311537
Length: 33

DNA sequence
>NC_015144, from 311505 to 311537 (33 bp); Weeksella virosa DSM 16922 TTTTTATTACTTTTTTATTACTTTTTTATTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 311512-311982	Sequence	Weevi_0323 - hypothetical protein (Protein is coded in complementary strand; from 311982 to 311512)