Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 296826
End position: 296861
Length: 36

DNA sequence
>NC_015144, from 296826 to 296861 (36 bp); Weeksella virosa DSM 16922 TATTTCTGGTTCTGGTTCTGGTTCTGGTTCTGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 296173-297132	Sequence	Weevi_0308 - hypothetical protein (Protein is coded in complementary strand; from 297132 to 296173)