Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 270066
End position: 270092
Length: 27

DNA sequence
>NC_015144, from 270066 to 270092 (27 bp); Weeksella virosa DSM 16922 TTATTTATTTTGTTTATTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 270080-270292	Sequence	Weevi_0280 - DNA/RNA repair helicase (Protein is coded in complementary strand; from 270292 to 270080)