Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 266845
End position: 266868
Length: 24

DNA sequence
>NC_015144, from 266845 to 266868 (24 bp); Weeksella virosa DSM 16922 TCATTTTCATATTCATATTCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 266428-267297	Sequence	Weevi_0272 - hypothetical protein (Protein is coded in complementary strand; from 267297 to 266428)