Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 265164
End position: 265187
Length: 24

DNA sequence
>NC_015144, from 265164 to 265187 (24 bp); Weeksella virosa DSM 16922 AATTTTAGTTTTGATTTTCATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 265188-265685	Sequence	Weevi_0270 - replication initiation factor DnaA protein (Protein is coded in complementary strand; from 265685 to 265188)