Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 2089514
End position: 2089546
Length: 33

DNA sequence
>NC_015144, from 2089514 to 2089546 (33 bp); Weeksella virosa DSM 16922 TATAATTCTTTTATAAATGTTTCTTAATTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2088286-2089515	Sequence	Weevi_1947 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 2089515 to 2088286)