Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 1368747
End position: 1368779
Length: 33

DNA sequence
>NC_015144, from 1368747 to 1368779 (33 bp); Weeksella virosa DSM 16922 AATAAAACTAAAATAGAACAAAAATGAAACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1368084-1368752	Sequence	Weevi_1290 - hypothetical protein
ORF... 1368771-1369160	Sequence	Weevi_1291 - hypothetical protein