Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 128558
End position: 128585
Length: 28

DNA sequence
>NC_015144, from 128558 to 128585 (28 bp); Weeksella virosa DSM 16922 CATTTTTCATTTTACTTTTTTCATTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 128256-128561	Sequence	Weevi_0128 - hypothetical protein (Protein is coded in complementary strand; from 128561 to 128256)