Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 1160725
End position: 1160749
Length: 25

DNA sequence
>NC_015144, from 1160725 to 1160749 (25 bp); Weeksella virosa DSM 16922 TGTTTTGATTTCTTTTCTTTTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1160517-1161473	Sequence	Weevi_1098 - Mg2 transporter protein CorA family protein