Sequence retrieval

Genome: Weeksella virosa DSM 16922
Start position: 1138871
End position: 1138894
Length: 24

DNA sequence
>NC_015144, from 1138871 to 1138894 (24 bp); Weeksella virosa DSM 16922 ATAACCATACCCATATCCATAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1138806-1141202	Sequence	Weevi_1081 - capsular exopolysaccharide family protein (Protein is coded in complementary strand; from 1141202 to 1138806)