Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 826851
End position: 826895
Length: 45

DNA sequence
>NC_015064, from 826851 to 826895 (45 bp); Acidobacterium sp. MP5ACTX9 GCGGGACGCGGAGCAGCGGGACGGGCTGCAGCAGGACGCGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 826842-827495	Sequence	AciX9_0686 - outer membrane chaperone Skp (Protein is coded in complementary strand; from 827495 to 826842)