Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 825969
End position: 825992
Length: 24

DNA sequence
>NC_015064, from 825969 to 825992 (24 bp); Acidobacterium sp. MP5ACTX9 GCTTCGGCTTCCGCTGCGGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 824961-826763	Sequence	AciX9_0685 - GTP-binding protein LepA