Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 798363
End position: 798386
Length: 24

DNA sequence
>NC_015064, from 798363 to 798386 (24 bp); Acidobacterium sp. MP5ACTX9 GGATGGCGATGGGGGTGGGGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 798119-798997	Sequence	AciX9_0658 - hypothetical protein (Protein is coded in complementary strand; from 798997 to 798119)