Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 463056
End position: 463082
Length: 27

DNA sequence
>NC_015064, from 463056 to 463082 (27 bp); Acidobacterium sp. MP5ACTX9 CGTCGTCGGCGTCGACGGCGTTGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 461732-463609	Sequence	AciX9_0382 - ErfK/YbiS/YcfS/YnhG family protein (Protein is coded in complementary strand; from 463609 to 461732)