Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 4245855
End position: 4245882
Length: 28

DNA sequence
>NC_015064, from 4245855 to 4245882 (28 bp); Acidobacterium sp. MP5ACTX9 GCAGGGAACAGGGATCAGGGAACAGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4244302-4246320	Sequence	AciX9_3733 - glucose inhibited division protein A (Protein is coded in complementary strand; from 4246320 to 4244302)