Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 4124439
End position: 4124465
Length: 27

DNA sequence
>NC_015064, from 4124439 to 4124465 (27 bp); Acidobacterium sp. MP5ACTX9 GGTGGAGGCGGTGGGGGCGGAGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4123890-4124636	Sequence	AciX9_3622 - TonB family protein (Protein is coded in complementary strand; from 4124636 to 4123890)