Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 4065924
End position: 4065947
Length: 24

DNA sequence
>NC_015064, from 4065924 to 4065947 (24 bp); Acidobacterium sp. MP5ACTX9 AGCAGCCGCAGCAGGAGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4065496-4067190	Sequence	AciX9_3563 - hypothetical protein (Protein is coded in complementary strand; from 4067190 to 4065496)