Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 4063530
End position: 4063557
Length: 28

DNA sequence
>NC_015064, from 4063530 to 4063557 (28 bp); Acidobacterium sp. MP5ACTX9 TAGCTGATAGCTCATAGCTCATAGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4063542-4064078	Sequence	AciX9_3561 - hypothetical protein (Protein is coded in complementary strand; from 4064078 to 4063542)