Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3953314
End position: 3953340
Length: 27

DNA sequence
>NC_015064, from 3953314 to 3953340 (27 bp); Acidobacterium sp. MP5ACTX9 CCACCCCCGCCACGCCCGCCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3953278-3953772	Sequence	AciX9_3455 - hypothetical protein (Protein is coded in complementary strand; from 3953772 to 3953278)