Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3858713
End position: 3858740
Length: 28

DNA sequence
>NC_015064, from 3858713 to 3858740 (28 bp); Acidobacterium sp. MP5ACTX9 TCAGGGCTCAGGGATAAGGGCCCAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3857360-3860242	Sequence	AciX9_3365 - valyl-tRNA synthetase (Protein is coded in complementary strand; from 3860242 to 3857360)