Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3836071
End position: 3836094
Length: 24

DNA sequence
>NC_015064, from 3836071 to 3836094 (24 bp); Acidobacterium sp. MP5ACTX9 CCTCCGCATCCGCCTCGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3835800-3836864	Sequence	AciX9_3343 - alkanesulfonate monooxygenase (Protein is coded in complementary strand; from 3836864 to 3835800)