Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3747269
End position: 3747304
Length: 36

DNA sequence
>NC_015064, from 3747269 to 3747304 (36 bp); Acidobacterium sp. MP5ACTX9 TTGCCGTTGCCGTTGCCGTTGCCGTTGCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3747203-3747442	Sequence	AciX9_3257 - hypothetical protein (Protein is coded in complementary strand; from 3747442 to 3747203)