Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3552400
End position: 3552427
Length: 28

DNA sequence
>NC_015064, from 3552400 to 3552427 (28 bp); Acidobacterium sp. MP5ACTX9 CTAGGCCCTAGTCCCTAGGCTCCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3552408-3552716	Sequence	AciX9_3078 - hypothetical protein (Protein is coded in complementary strand; from 3552716 to 3552408)