Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3118324
End position: 3118350
Length: 27

DNA sequence
>NC_015064, from 3118324 to 3118350 (27 bp); Acidobacterium sp. MP5ACTX9 CCCGCGGCTCCCACGGCTCCCACGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3117022-3118653	Sequence	AciX9_2676 - hypothetical protein (Protein is coded in complementary strand; from 3118653 to 3117022)