Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3071121
End position: 3071144
Length: 24

DNA sequence
>NC_015064, from 3071121 to 3071144 (24 bp); Acidobacterium sp. MP5ACTX9 CCCCAGCGCCAGCCCCAGCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3070693-3071559	Sequence	AciX9_2640 - 4-hydroxybenzoate polyprenyltransferase (Protein is coded in complementary strand; from 3071559 to 3070693)