Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 3066051
End position: 3066095
Length: 45

DNA sequence
>NC_015064, from 3066051 to 3066095 (45 bp); Acidobacterium sp. MP5ACTX9 CCGCACCCTTCTTCGCGGCAATCTTCTTCGCCGGAGCCTTCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3065711-3066148	Sequence	AciX9_2635 - hypothetical protein (Protein is coded in complementary strand; from 3066148 to 3065711)