Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2940315
End position: 2940356
Length: 42

DNA sequence
>NC_015064, from 2940315 to 2940356 (42 bp); Acidobacterium sp. MP5ACTX9 TTGCCGTTGCCGTTGCCGTTGCCGTTGCCGTTGCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2940177-2940458	Sequence	AciX9_2510 - hypothetical protein (Protein is coded in complementary strand; from 2940458 to 2940177)