Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2933717
End position: 2933746
Length: 30

DNA sequence
>NC_015064, from 2933717 to 2933746 (30 bp); Acidobacterium sp. MP5ACTX9 TTGCCGTTGCCGTTGCCGTTGCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2933627-2933788	Sequence	AciX9_2503 - minor extracellular protease VpR (Protein is coded in complementary strand; from 2933788 to 2933627)