Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2658723
End position: 2658746
Length: 24

DNA sequence
>NC_015064, from 2658723 to 2658746 (24 bp); Acidobacterium sp. MP5ACTX9 GGCGAGGGTGAGGGAGAGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2658565-2661240	Sequence	AciX9_2272 - UTP-GlnB uridylyltransferase, GlnD (Protein is coded in complementary strand; from 2661240 to 2658565)