Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2457550
End position: 2457585
Length: 36

DNA sequence
>NC_015064, from 2457550 to 2457585 (36 bp); Acidobacterium sp. MP5ACTX9 TGCTGTTGCTATTGCTGTTGCTATTGCTGTTGCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2457444-2457746	Sequence	AciX9_2102 - hypothetical protein (Protein is coded in complementary strand; from 2457746 to 2457444)