Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2456237
End position: 2456260
Length: 24

DNA sequence
>NC_015064, from 2456237 to 2456260 (24 bp); Acidobacterium sp. MP5ACTX9 CAGCACCAGCGCCACCACCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2456181-2457431	Sequence	AciX9_2101 - major facilitator superfamily protein (Protein is coded in complementary strand; from 2457431 to 2456181)