Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2105459
End position: 2105482
Length: 24

DNA sequence
>NC_015064, from 2105459 to 2105482 (24 bp); Acidobacterium sp. MP5ACTX9 TTCTCTTTTTTTCTTTTTATCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2105476-2105721	Sequence	AciX9_1811 - hypothetical protein (Protein is coded in complementary strand; from 2105721 to 2105476)