Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 2060523
End position: 2060546
Length: 24

DNA sequence
>NC_015064, from 2060523 to 2060546 (24 bp); Acidobacterium sp. MP5ACTX9 GGTGAGGTTGAGGCTGAGGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2059894-2060829	Sequence	AciX9_1764 - hypothetical protein (Protein is coded in complementary strand; from 2060829 to 2059894)