Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1883291
End position: 1883314
Length: 24

DNA sequence
>NC_015064, from 1883291 to 1883314 (24 bp); Acidobacterium sp. MP5ACTX9 CAGCAGCAGCATCGGCAGCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1882911-1883402	Sequence	AciX9_1628 - TadE family protein (Protein is coded in complementary strand; from 1883402 to 1882911)