Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1597859
End position: 1597888
Length: 30

DNA sequence
>NC_015064, from 1597859 to 1597888 (30 bp); Acidobacterium sp. MP5ACTX9 GCGCTCATGCGGGCTCCTGCTGGCTCATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1597526-1597867	Sequence	AciX9_1362 - hypothetical protein (Protein is coded in complementary strand; from 1597867 to 1597526)
ORF... 1597864-1598946	Sequence	AciX9_1363 - Agmatine deiminase (Protein is coded in complementary strand; from 1598946 to 1597864)