Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1274477
End position: 1274504
Length: 28

DNA sequence
>NC_015064, from 1274477 to 1274504 (28 bp); Acidobacterium sp. MP5ACTX9 CAGGGATCGGGGATCAGGGACCAGGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1272647-1275457	Sequence	AciX9_1090 - peptidase S45 penicillin amidase (Protein is coded in complementary strand; from 1275457 to 1272647)