Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1266246
End position: 1266272
Length: 27

DNA sequence
>NC_015064, from 1266246 to 1266272 (27 bp); Acidobacterium sp. MP5ACTX9 GGATGGTGCGGATGGGGCGGAAGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1265672-1266931	Sequence	AciX9_1083 - major facilitator superfamily protein (Protein is coded in complementary strand; from 1266931 to 1265672)