Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1252278
End position: 1252301
Length: 24

DNA sequence
>NC_015064, from 1252278 to 1252301 (24 bp); Acidobacterium sp. MP5ACTX9 GGCGACGGCGGCGGCGATGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1252072-1252494	Sequence	AciX9_1072 - cytidine deaminase (Protein is coded in complementary strand; from 1252494 to 1252072)