Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1134577
End position: 1134612
Length: 36

DNA sequence
>NC_015064, from 1134577 to 1134612 (36 bp); Acidobacterium sp. MP5ACTX9 GTTGCAGTTGCAGTTGCAGTTGCAGTTGCAGTTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134413-1134709	Sequence	AciX9_0959 - hypothetical protein (Protein is coded in complementary strand; from 1134709 to 1134413)